Spink12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spink12^em1(IMPC)J
• Name: serine peptidase inhibitor, Kazal type 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5649013
• Synonyms: Spink12^em1J
• Gene: Spink12 Location: Chr18:44237474-44241610 bp, + strand Genetic Position: Chr18, 23.74 cM, cytoband B3
• Alliance: Spink12^em1(IMPC)J page
• IMPC: Spink12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Spink12-6847-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATTGTGGTTAGCTGCAACT, AGGAGGCTTTCAGGTATGTA and CCCCAGTGCTTAAGTTGGAA, which resulted in a 109 bp deletion beginning in intron 2 at Chromosome 18 negative strand position 44,106,529 bp starting at CCTTGGCTCACAGCATCTACAGTGA and ending after ATGGGGTTCTGCTGCGTCTGT at position 44,106,421 bp in exon 3 (GRCm38). This mutation results in a 93bp deletion in intron 2 and 16bp deletion in exon 2 removing the splice donor, which is predicted to prevent splicing to exon 2 and to result in amino acid changes after residue 38 and early truncation 6 residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Spink12 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)