About   Help   FAQ
Dbn1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dbn1em1(IMPC)J
Name: drebrin 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5645712
Synonyms: Dbn1em1J
Gene: Dbn1  Location: Chr13:55621241-55635874 bp, - strand  Genetic Position: Chr13, 30.06 cM
Alliance: Dbn1em1(IMPC)J page
IMPC: Dbn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dbn1-6662J-M9006 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCTACACCCGTCACCCTGCA, TGACGCTGCAGAAACCATAC and GGTGGAATGTGGCCGCTCCG, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 108bp deletion beginning in intron 3 at GTAGGAGATGGGGAGTCCCAA at Chromosome 13 negative strand position 55,482,845 bp (GRCm38) and ending after ATGTATGGTTTCTGCAGCGT at position 55,482,738 bp in exon 3. This mutation deletes part of exon 3 and is predicted to cause amino acid sequence changes after residue 47 and early truncation 46 amino acids later. This allele also has an additional 48bp deletion in intron 4 from Chromosome 13 negative strand position 55,482,666 bp to 55,482,619 bp, which is not expected to affect the protein. PCR failed to detect the insertion of any loxP sites. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dbn1 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory