About   Help   FAQ
Serpina3nem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpina3nem1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5644715
Synonyms: Serpina3nem1J
Gene: Serpina3n  Location: Chr12:104372988-104380588 bp, + strand  Genetic Position: Chr12, 54.17 cM, cytoband F1
Alliance: Serpina3nem1(IMPC)J page
IMPC: Serpina3n gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Serpina3n-6845J-M9384 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTCAGAAGCGGTGTTAACTG, AGTGCCCATGATGAGCATGG and CCTGTTCTGTCCTCAGCCTA which resulted in a 402 bp deletion and an 8 bp insertion (ACAGTGTA) in intron 3 at Chromosome 12 positive strand position 104,411,059 bp (TAACTGAGGAGAAGGTGGAGTCTCTG in GRCm38) and ending after CTGTTCTGTCCTCAGCCTAAGGCC at position 104,411,460 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 212 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serpina3n Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory