Rab11fip4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab11fip4^em1(IMPC)J
• Name: RAB11 family interacting protein 4 (class II); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644714
• Synonyms: Rab11fip4^em1J
• Gene: Rab11fip4 Location: Chr11:79482038-79588849 bp, + strand Genetic Position: Chr11, 46.88 cM
• Alliance: Rab11fip4^em1(IMPC)J page
• IMPC: Rab11fip4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab11fip4-6842J-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CGTCTACAAGTGCGTCTGCA, ATGACATTGGCCCTACCTGA and ACGGGTACTTTCTAGCTCCG, which resulted in a 405bp deletion beginning in intron 4 at CGTGACTCAGCCACCATGAGAG at Chromosome 11 positive strand position 79,680,652 bp (GRCm38) and ending after TTTCTAGCTCCGGGGCCACATGCC at position 79,681,056 bp in intron 5. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 112 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rab11fip4 Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)