Oard1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Oard1^em1(IMPC)J
• Name: O-acyl-ADP-ribose deacylase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644469
• Synonyms: Oard1^em1J
• Gene: Oard1 Location: Chr17:48717042-48724294 bp, + strand Genetic Position: Chr17, 23.99 cM
• Alliance: Oard1^em1(IMPC)J page
• IMPC: Oard1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Oard1-6555J-F6345 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCAAAACAGACTCTCTAGCCCAT and ATCAGTGAGGATTGTCGAAT, which resulted in a 287 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 48,411,029 bp, CTGATTTACTTAGAAAAGGC, and ending after GTCCCAAAACAGACTCTCTAG in exon 3 at 48,411,315 bp (GRCm38/mm10). This mutation deletes part of exon 3 and the splice acceptor and is predicted to cause the complete loss of exon 3 resulting in amino acid sequence changes after 13 residues and early truncation 9 amino acid residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Oard1 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)