Ubn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubn1^em1(IMPC)J
• Name: ubinuclein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5629302
• Synonyms: Ubn1^em1J
• Gene: Ubn1 Location: Chr16:4867921-4904153 bp, + strand Genetic Position: Chr16, 2.49 cM
• Alliance: Ubn1^em1(IMPC)J page
• IMPC: Ubn1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ubn1-6239J-105P8MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACGTAGGAAAGACCGAATAC which resulted in a 7 bp deletion ACCGAAT in exon 5 beginning at Chromosome 16 positive strand position 5,062,557 - 5,062,563 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 121 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ubn1 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)