About   Help   FAQ
Pigcem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pigcem1(IMPC)J
Name: phosphatidylinositol glycan anchor biosynthesis, class C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5629300
Synonyms: Pigcem1J
Gene: Pigc  Location: Chr1:161796755-161801004 bp, + strand  Genetic Position: Chr1, 69.95 cM
Alliance: Pigcem1(IMPC)J page
IMPC: Pigc gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pigc-6237J-103MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences TGTAGTGATCTGGTGGTACA and CCCCAGTGGCTTTTTGGGAC, which resulted in a 1 bp deletion, T, in exon1 at Chromosome 1 positive strand position 161,970,654 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 67 and early truncation 1 amino acid later. There is an additional 11 bp deletion, tggctccccag, 34 bp after the 1 bp deletion, in exon 1 beginning at Chromosome 1 positive strand position 161,970,689. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pigc Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory