Poc1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Poc1a^em1(IMPC)J
• Name: POC1 centriolar protein A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5620147
• Synonyms: Poc1a^em1J
• Gene: Poc1a Location: Chr9:106158260-106227720 bp, + strand Genetic Position: Chr9, 57.46 cM, cytoband F1
• Alliance: Poc1a^em1(IMPC)J page
• IMPC: Poc1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Poc1a-5675J-3728 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GGCAAGAAGGTGTCCCGATG and GAGACAAGACTGTTCGCATC, which resulted in a 30 bp deletion CTCCCCATCGGGACACCTTCTTGCCTCAGG in exon3 beginning at Chromosome 9 positive strand position 106,284,984 - 106,285,013 bp (GRCm38). This mutation is predicted to cause a 10 amino acid in-frame deletion after residue 70. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Poc1a Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)