Ncoa6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncoa6^em1(IMPC)J
• Name: nuclear receptor coactivator 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5607863
• Synonyms: Ncoa6^em1J
• Gene: Ncoa6 Location: Chr2:155232585-155315741 bp, - strand Genetic Position: Chr2, 77.26 cM, cytoband H2
• Alliance: Ncoa6^em1(IMPC)J page
• IMPC: Ncoa6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ncoa6-6076J-P6MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATCTACAATGGGCGACTCAG, which resulted in an 11 bp deletion GGCGACTCAGA in exon2 beginning at Chromosome 2 negative strand position 155,437,978 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 22 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ncoa6 Mutation: 100 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)