Zfp219^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp219^em1(IMPC)J
• Name: zinc finger protein 219; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5607861
• Synonyms: Zfp219^em1J
• Gene: Zfp219 Location: Chr14:52243534-52258190 bp, - strand Genetic Position: Chr14, 26.76 cM
• Alliance: Zfp219^em1(IMPC)J page
• IMPC: Zfp219 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp219-6028J-P3MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GATCTGCAGCGCTACTCCAA, which resulted in a 19 bp deletion CGCTACTCCAACGGACCAG in exon 2 beginning at Chromosome 14 negative strand position 52,009,555 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 25 and early truncation 46 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp219 Mutation: 130 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)