Plk5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plk5^em1(IMPC)J
• Name: polo like kinase 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5585597
• Synonyms: Plk5^em1J
• Gene: Plk5 Location: Chr10:80192293-80201323 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Plk5^em1(IMPC)J page
• IMPC: Plk5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intragenic deletion, Single point mutation
• Mutation details: This allele from project Plk5-5922J-4194 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CGAGCCTGGGTCGCGCAGGA, which resulted in a 1 bp deletion G in exon 1 beginning at Chromosome 10 positive strand position 80356646 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 28 and an early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Plk5 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)