Gt(ROSA)26Sortm9(CAG-GFP*)Nat
Targeted Allele Detail
|
Symbol: |
Gt(ROSA)26Sortm9(CAG-GFP*)Nat |
Name: |
gene trap ROSA 26, Philippe Soriano; targeted mutation 9, Jeremy Nathans |
MGI ID: |
MGI:5578178 |
Synonyms: |
R26 mLSL-nGFP |
Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
Alliance: |
Gt(ROSA)26Sortm9(CAG-GFP*)Nat page
|
|
Germline Transmission: |
Earliest citation of germline transmission:
J:101977
|
Parent Cell Line: |
Not Specified (ES Cell)
|
Strain of Origin: |
129
|
|
Allele Type: |
|
Targeted (Conditional ready, Reporter) |
Mutation: |
|
Insertion
|
|
|
Mutation details: The targeting vector containins (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.
(J:101977)
|
|
|
|
Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
All: |
2 reference(s) |
|