About   Help   FAQ
Fxnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fxnem1(IMPC)J
Name: frataxin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5571595
Synonyms: Fxnem1J
Gene: Fxn  Location: Chr19:24238817-24257969 bp, - strand  Genetic Position: Chr19, 19.39 cM, cytoband C1
Alliance: Fxnem1(IMPC)J page
IMPC: Fxn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fxn-5659J-106A was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGTAGCATGTGGGCGTTCGG, which resulted in a 4 bp deletion TTCG in exon 1 beginning at Chromosome 19 negative strand position 24,280,560 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fxn Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory