About   Help   FAQ
Arxtm5Kki
Targeted Allele Detail
Nomenclature
Symbol: Arxtm5Kki
Name: aristaless related homeobox; targeted mutation 5, Kunio Kitamura
MGI ID: MGI:5559563
Synonyms: Arx432-455dup, Arx432-455dup24
Gene: Arx  Location: ChrX:93286507-93298357 bp, + strand  Genetic Position: ChrX, 41.05 cM
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:152416
Parent Cell Line:  CCE/EK.CCE (ES Cell)
Strain of Origin:  129S/SvEv-Gpi1c
Mutation
description
Allele Type:    Targeted
Mutations:    Insertion, Single point mutation
 
Mutation detailsExon 2 was replaced with one in which coding nucleotide 437 (T), the second base in valine codon 146 at the start of the second poly-alanine stretch, was replaced with a C and had a duplication of nucleotides coding for poly-alanine sequence inserted after it (c.437T>CGGCTGCCGCCGCTGCCGCTGCAGC). Note that this duplicated sequence cannot be found as a contigous sequence in either C57BL/6J or 129S1/SvImJ, but rather as two separate sequences in two separate poly-alanine stretches in exon 2. This results in a protein with a longer second poly-alanine repeat (p.(V146delinsAAAAAAAAA)). A neomycin resistance cassette was inserted into intron 1. Western blot analysis showed reduced protein expression. (J:152416)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 2 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Arx Mutation:  19 strains or lines available
References
Original:  J:152416 Kitamura K, et al., Three human ARX mutations cause the lissencephaly-like and mental retardation with epilepsy-like pleiotropic phenotypes in mice. Hum Mol Genet. 2009 Oct 1;18(19):3708-24
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/05/2019
MGI 6.14
The Jackson Laboratory