About   Help   FAQ
Itgaeem1(cre/ERT2)Tber
Endonuclease-mediated Allele Detail
Summary
Symbol: Itgaeem1(cre/ERT2)Tber
Name: integrin alpha E, epithelial-associated; endonuclease-mediated mutation 1, Tessa Bergsbaken
MGI ID: MGI:8386600
Gene: Itgae  Location: Chr11:72981409-73038272 bp, + strand  Genetic Position: Chr11, 45.22 cM
Alliance: Itgaeem1(cre/ERT2)Tber page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Itgaeem1(cre/ERT2)Tber expression driven by 1 gene
 
Mutation details: 

Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (CTATTTCTAGCTCTAAAACAGATTAGCCCCCTGCTTCCTATAGTGAGTCGTATTA) was used to introduce an IRES-icre/ERT2 fusion gene (a codon-optimized Cre recombinase fused to a human estrogen receptor ligand binding domain) between exon 31 and the 3' UTR of the integrin alpha E, epithelial-associated (Itgae) gene. (J:101977, J:389475)

Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Itgae (mouse)
Summary of all recombinase alleles driven by Itgae.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Itgae Mutation:  84 strains or lines available
References
Original:  J:389475 Fung HY, et al., CD103 fate mapping reveals that intestinal CD103(-) tissue-resident memory T cells are the primary responders to secondary infection. Sci Immunol. 2022 Nov 11;7(77):eabl9925
All:  2 reference(s)
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
09/15/2026
MGI 6.29 		The Jackson Laboratory