About   Help   FAQ
Lrrn4em1(icre/ERT2)Gngli
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrrn4em1(icre/ERT2)Gngli
Name: leucine rich repeat neuronal 4; endonuclease-mediated mutation 1, Guang Li
MGI ID: MGI:8297266
Gene: Lrrn4  Location: Chr2:132710225-132722811 bp, - strand  Genetic Position: Chr2, 64.78 cM
Alliance: Lrrn4em1(icre/ERT2)Gngli page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Lrrn4em1(icre/ERT2)Gngli expression driven by 1 gene
 
Mutation details: A sgRNA (ggtttgtttaatctggttgc tgg) was designed to insert a viral P2A oligopeptide (P2A) and an icre/ERT2 fusion gene (a mammalian codon-optimized Cre recombinase fused to a human estrogen receptor ligand binding domain) at the 3' end of the last exon of the leucine rich repeat neuronal 4 (Lrrn4) gene. (J:101977)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Lrrn4 (mouse)
Summary of all recombinase alleles driven by Lrrn4.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lrrn4 Mutation:  35 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
03/24/2026
MGI 6.24 		The Jackson Laboratory