Scd3em2(icre/ERT2)Drmn
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Scd3em2(icre/ERT2)Drmn |
| Name: |
stearoyl-coenzyme A desaturase 3; endonuclease-mediated mutation 2, Daniel Rosenberg |
| MGI ID: |
MGI:8288972 |
| Gene: |
Scd3 Location: Chr19:44191727-44232455 bp, + strand Genetic Position: Chr19, 37.98 cM, cytoband D2
|
| Alliance: |
Scd3em2(icre/ERT2)Drmn page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Inducible, Recombinase) |
| Inducer: |
|
tamoxifen |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Scd3em2(icre/ERT2)Drmn expression driven by
1 gene
Knock-in expression driven by:
|
| |
|
Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, guide RNAs (AAGAAGGTATGCAGCCCGTGAGG, GGTATGCAGCCCGTGAGGTAAGG, CTGTCTTGTTATAACTCAAGAGG and GTCTTGTTATAACTCAAGAGGGG) were used to replace exons 1-2 of a truncated isoform of the stearoyl-coenzyme A desaturase 3 (Scd3) gene with a codon-optimized icre/ERT2 fusion gene (iCre recombinase fused to a human estrogen receptor ligand binding domain) followed by a P2A peptide.
(J:94077)
|
|
|
|
Activity: |
 Tissue activity of this recombinase allele
|
|
Driver:
|
Scd3
(mouse)
|
| |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Scd3 Mutation: |
17 strains or lines available
|
|
| Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
| All: |
1 reference(s) |
|
Analysis Tools
