About   Help   FAQ
Slco1c1em1(icre/ERT2)Wopg
Endonuclease-mediated Allele Detail
Summary
Symbol: Slco1c1em1(icre/ERT2)Wopg
Name: solute carrier organic anion transporter family, member 1c1; endonuclease-mediated mutation 1, Woo-ping Ge
MGI ID: MGI:8280765
Synonyms: Slco1c1-CreERKI, Slco1c1-KIP2A- iCreERT2
Gene: Slco1c1  Location: Chr6:141470094-141515903 bp, + strand  Genetic Position: Chr6, 72.38 cM, cytoband G1
Alliance: Slco1c1em1(icre/ERT2)Wopg page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Slco1c1em1(icre/ERT2)Wopg expression driven by 1 gene
 
Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AAAGGAGACATGCGCTGCAAGG) was used to introduce aP2A-iCreERT2 cassette immediately after stop codon of the solute carrier organic anion transporter family, member 1c1 (Slco1c1) gene. (J:101977, J:373008)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Slco1c1 (mouse)
Summary of all recombinase alleles driven by Slco1c1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Slco1c1 Mutation:  33 strains or lines available
References
Original:  J:373008 Gao X, et al., Reduction of neuronal activity mediated by blood-vessel regression in the adult brain. Nat Commun. 2025 Jul 1;16(1):5840
All:  2 reference(s)
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
01/28/2026
MGI 6.24 		The Jackson Laboratory