About   Help   FAQ
Ptprmem1(icre/ERT2)Zjh
Endonuclease-mediated Allele Detail
Summary
Symbol: Ptprmem1(icre/ERT2)Zjh
Name: protein tyrosine phosphatase receptor type M; endonuclease-mediated mutation 1, Z Josh Huang
MGI ID: MGI:8240188
Gene: Ptprm  Location: Chr17:66973942-67661452 bp, - strand  Genetic Position: Chr17, 37.88 cM
Alliance: Ptprmem1(icre/ERT2)Zjh page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Ptprmem1(icre/ERT2)Zjh expression driven by 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (AGCCCGAATTCAGGTACTCC AGG) was used to introduce a T2A peptide followed by an icre/ERT2 fusion gene (codon-improved Cre recombinase fused to a human estrogen receptor ligand binding domain) into the 3' UTR, immediately after the endogenous stop codon of the protein tyrosine phosphatase receptor type M (Ptprm) gene. (J:101977)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Ptprm (mouse)
Summary of all recombinase alleles driven by Ptprm.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ptprm Mutation:  59 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory