About   Help   FAQ
Kcnh5em1(icre/ERT2)Zjh
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnh5em1(icre/ERT2)Zjh
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5; endonuclease-mediated mutation 1, Z Josh Huang
MGI ID: MGI:8240176
Gene: Kcnh5  Location: Chr12:74943994-75224106 bp, - strand  Genetic Position: Chr12, 32.62 cM
Alliance: Kcnh5em1(icre/ERT2)Zjh page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Kcnh5em1(icre/ERT2)Zjh expression driven by 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GTACATACTGCATGTCCAGCTGG) was used to introduce a T2A peptide followed by a cre/ERT2 fusion gene (an optimized iCre recombinase fused to a human estrogen receptor ligand binding domain) into the 3' UTR, immediately after the endogenous stop codon of the potassium voltage-gated channel, subfamily H (eag-related), member 5 (Kcnh5) gene. (J:101977)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Kcnh5 (mouse)
Summary of all recombinase alleles driven by Kcnh5.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnh5 Mutation:  59 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory