About   Help   FAQ
Cntn2em1(cre/ERT2)Forni
Endonuclease-mediated Allele Detail
Summary
Symbol: Cntn2em1(cre/ERT2)Forni
Name: contactin 2; endonuclease-mediated mutation 1, Paolo E Forni
MGI ID: MGI:8189955
Synonyms: Cntn2CreERT2
Gene: Cntn2  Location: Chr1:132437163-132470989 bp, - strand  Genetic Position: Chr1, 57.42 cM
Alliance: Cntn2em1(cre/ERT2)Forni page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Cntn2em1(cre/ERT2)Forni expression driven by 1 gene
 
Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (AGCGTTGAGATCAGAGCCTCTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide downstream of exon 23 of the contactin 2 (Cntn2) gene. (J:369667)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Cntn2 (mouse)
Summary of all recombinase alleles driven by Cntn2.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cntn2 Mutation:  56 strains or lines available
References
Original:  J:369667 Amato E Jr, et al., Tracing Early Migratory Neurons in the Developing Nose Using Contactin-2 (Cntn2) CreERT2. Genesis. 2025 Aug;63(4):e70021
All:  1 reference(s)
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
07/22/2025
MGI 6.24 		The Jackson Laboratory