About   Help   FAQ
Ecel1em1(icre)Gfng
Endonuclease-mediated Allele Detail
Summary
Symbol: Ecel1em1(icre)Gfng
Name: endothelin converting enzyme-like 1; endonuclease-mediated mutation 1, Guoping Feng
MGI ID: MGI:8166497
Synonyms: Ecel1-Cre, Ecel1em1(cre)Gfng
Gene: Ecel1  Location: Chr1:87075377-87084243 bp, - strand  Genetic Position: Chr1, 44.06 cM, cytoband C5
Alliance: Ecel1em1(icre)Gfng page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Recombinase)
Mutation:    Insertion
 
Ecel1em1(icre)Gfng expression driven by 1 gene
 
Mutation detailssgRNAs (AGTGCTCTGTGTGGTGAGCC and CCAGGCCCTCGCTTAAGTGA) were used to target sequences immediately before the stop codon of the endothelin converting enzyme-like 1 (Ecel1) gene for insertion of a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a codon improved Cre (iCre) recombinase sequence (icre). (J:101977, J:361365)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Ecel1 (mouse)
Summary of all recombinase alleles driven by Ecel1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ecel1 Mutation:  41 strains or lines available
References
Original:  J:361365 Hartley ND, et al., Distinct structural and functional connectivity of genetically segregated thalamoreticular subnetworks. Cell Rep. 2024 Dec 24;43(12):115037
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory