About   Help   FAQ
Lyve1em1(cre/ERT2)Jkpns
Endonuclease-mediated Allele Detail
Summary
Symbol: Lyve1em1(cre/ERT2)Jkpns
Name: lymphatic vessel endothelial hyaluronan receptor 1; endonuclease-mediated mutation 1, Jonathan Kipnis
MGI ID: MGI:7859688
Synonyms: Lyve1creERT2
Gene: Lyve1  Location: Chr7:110449814-110462160 bp, - strand  Genetic Position: Chr7, 57.89 cM, cytoband F2
Alliance: Lyve1em1(cre/ERT2)Jkpns page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inducible, Recombinase)
Inducer:    tamoxifen
Mutation:    Insertion
 
Lyve1em1(cre/ERT2)Jkpns expression driven by 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (GAAGTTTAGATGCAAGAGAGTGG) was used to introduce a cre/ERT2 fusion gene (a Cre recombinase fused to a human estrogen receptor ligand binding domain) fused to a P2A self-cleaving peptide immediately upstream of the 3' UTR of the lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) gene on chromosome 7. (J:101977, J:382781)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Lyve1 (mouse)
Summary of all recombinase alleles driven by Lyve1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lyve1 Mutation:  17 strains or lines available
References
Original:  J:382781 Du S, et al., Brain-engrafted monocyte-derived macrophages from blood and skull-bone marrow exhibit distinct properties. Neuron. 2026 Mar 11;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory