About   Help   FAQ
Slc34a1em1(EGFP/cre)Jsprk
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc34a1em1(EGFP/cre)Jsprk
Name: solute carrier family 34 (sodium phosphate), member 1; endonuclease-mediated mutation 1, Joo-Seop Park
MGI ID: MGI:7856708
Synonyms: Slc34a1eGFPCre
Gene: Slc34a1  Location: Chr13:55547435-55562508 bp, + strand  Genetic Position: Chr13, 29.81 cM, cytoband B
Alliance: Slc34a1em1(EGFP/cre)Jsprk page
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Recombinase, Reporter)
Mutation:    Insertion
 
Slc34a1em1(EGFP/cre)Jsprk expression driven by 1 gene
 
Mutation detailsUsing CRISPR technology zygote carrying Slc34a1tm1(EGFP/cre/ERT2)Bhum allele was targeted with sgRNA (GGCGATCTCGAGCCATCTGC) designed to target the cre(ERT2) sequence in the SLC34a1(GCE) mutation to introduce a stop codon after the coding sequence of cre, creating a constitutively active cre-expressing allele. (J:101977, J:361196)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Slc34a1 (mouse)
Summary of all recombinase alleles driven by Slc34a1.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc34a1 Mutation:  43 strains or lines available
References
Original:  J:361196 Chung E, et al., The thin descending limb of the loop of Henle originates from proximal tubule cells during mouse kidney development. bioRxiv. 2025;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory