Tg(Taar4-Venus)HD2Tboz
Transgene Detail
|
|
| Symbol: |
Tg(Taar4-Venus)HD2Tboz |
| Name: |
transgene insertion HD2, Thomas Bozza |
| MGI ID: |
MGI:7714927 |
| Synonyms: |
5xHD-deltaT4YFPtg |
| Transgene: |
Tg(Taar4-Venus)HD2Tboz Location: unknown
|
| Alliance: |
Tg(Taar4-Venus)HD2Tboz page
|
|
|
|
| Transgene Type: |
|
Transgenic (Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: The transgene contains the following elements: ~2.3 kb sequence from upstream of the Taar4 TSS with 5 copies of homeodomain sequence ACATAACTTTTTAATGAGTCT inserted ~2 kb upstream of the TSS, the 5' UTR exons and intron, the Venus reporter gene (including Kozak sequence GCCACCATG upstream; replaces Taar4 CDS) and 1.3 kb sequence from downstream of the Taar4 CDS.
(J:343906)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
|
| Original: |
J:343906 Shah A, et al., Olfactory expression of trace amine-associated receptors requires cooperative cis-acting enhancers. Nat Commun. 2021 Jun 18;12(1):3797 |
| All: |
1 reference(s) |
|
Analysis Tools
