Summary | Mutation origin | Mutation description | Recombinase activity | Find Mice (IMSR) | References

Symbol:	Klf1em1(icre)Jbkr
Name:	Kruppel-like transcription factor 1 (erythroid); endonuclease-mediated mutation 1, James J Bieker
MGI ID:	MGI:7616745
Synonyms:	EKLF-CRE
Gene:	Klf1  Location: Chr8:85628611-85631920 bp, + strand  Genetic Position: Chr8, 41.3 cM
Alliance:	Klf1em1(icre)Jbkr page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Recombinase) Mutation:    Insertion   Klf1em1(icre)Jbkr expression driven by 1 gene Knock-in expression driven by: Organism Driver Gene Note mouse Klf1 (MGI:1342771)   Mutation details: Using CRISPR technology, sgRNA (based on ATCTTTTGGGATACGGTCCT) was designed to insert a T2A self-cleaving peptide sequence, flanked by linkers, followed by a codon improved icre sequence into the C-terminal of the Klf1 gene fused in-frame to the final leucine amino acid. (J:346489)

Activity:	Tissue activity of this recombinase allele
Driver:	Klf1 (mouse) Summary of all recombinase alleles driven by Klf1. Alliance mouse Klf1 gene page

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Klf1 Mutation:	21 strains or lines available

Original:	J:346489 Xue L, et al., Generation, characterization, and use of EKLF(Klf1)/CRE knock-in mice for cell-restricted analyses. Front Hematol. 20242;2
All:	1 reference(s)