Summary | Mutation origin | Mutation description | Recombinase activity | Find Mice (IMSR) | References

Symbol:	Foxi3em2(cre/ERT2)Akg
Name:	forkhead box I3; endonuclease-mediated mutation 2, Andrew K Groves
MGI ID:	MGI:7522306
Synonyms:	Foxi3CreER
Gene:	Foxi3  Location: Chr6:70933590-70938050 bp, + strand  Genetic Position: Chr6, 32.14 cM
Alliance:	Foxi3em2(cre/ERT2)Akg page

Germline Transmission:	Earliest citation of germline transmission: J:339365
Parent Cell Line:	AB2.2 (ES Cell)
Strain of Origin:	129S7/SvEvBrd-Hprt1b-m2

Allele Type:    Endonuclease-mediated (Inducible, Null/knockout, Recombinase, Reporter) Inducer:    tamoxifen Mutations:    Insertion, Intragenic deletion   Foxi3em2(cre/ERT2)Akg expression driven by 1 gene Knock-in expression driven by: Organism Driver Gene Note mouse Foxi3 (MGI:3511278)   Mutation details: Using CRISPR/cas9 genome editing, the entire coding sequence of the forkhead box I3 (Foxi3 locus on chromosome 6) was replaced with a (from 5' to 3') CreERT2 fusion cDNA, P2A peptide sequence followed by enhanced green fluorescent protein (eGFP), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a polyA signal, and a PGK-neo resistance cassette. This entire construct was electroporated, with CRISPR-assisted targeting vectors (gRNA CCCCCGGGATGGCTCTGATATA), in embryonic stem (ES) cells. (J:339365)

Activity:	Tissue activity of this recombinase allele
Driver:	Foxi3 (mouse) Summary of all recombinase alleles driven by Foxi3. Alliance mouse Foxi3 gene page

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Foxi3 Mutation:	22 strains or lines available

Original:	J:339365 Ankamreddy H, et al., Foxi3(GFP) and Foxi3(CreER) mice allow identification and lineage labeling of pharyngeal arch ectoderm and endoderm, and tooth and hair placodes. Dev Dyn. 2023 Aug 6;
All:	2 reference(s)