Rr330<em2Mam> Endonuclease-mediated Allele Detail MGI Mouse (MGI:7438006)

About Help FAQ

Rr330^em2Mam
Endonuclease-mediated Allele Detail

Summary | Mutation origin | Mutation description | Find Mice (IMSR) | Notes | References

Summary

Symbol:	Rr330^em2Mam
Name:	regulatory region 330; endonuclease-mediated mutation 2, Lothar Hennighausen
MGI ID:	MGI:7438006
Synonyms:	GASdeltaE2/3
Gene:	Rr330 Location: unknown Genetic Position: Chr11, Syntenic
Alliance:	Rr330^em2Mam page

Mutation
origin

Strain of Origin:

C57BL/6

Mutation
description

Allele Type:		Endonuclease-mediated (Modified regulatory region)
Mutation:		Intergenic deletion
		Mutation details: CRISPR-targeting using sgRNAs (targeting GGTCGGGAAGCCAGAAGGTTCT and GGTCTTCATTCCTAGAACCTTC) deleted 11 bp (GGTTCTAGGAA), which includes the interferonactivated sequence (GAS) motif, within the E3 enhancer (part of Wap super enhancer) upstream of Wap. (J:277922)

Find Mice (IMSR)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available Cell Lines: 0 lines available
Carrying any Rr330 Mutation:	0 strains or lines available

Notes

This mutation occurs with Rr329^em3Mam.

References

Original:	J:277922 Shin HY, et al., Hierarchy within the mammary STAT5-driven Wap super-enhancer. Nat Genet. 2016 Aug;48(8):904-911
All:	1 reference(s)

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13