Rr329em2Mam
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr329em2Mam |
| Name: |
regulatory region 329; endonuclease-mediated mutation 2, Lothar Hennighausen |
| MGI ID: |
MGI:7408218 |
| Synonyms: |
GASdeltaE1a/2 |
| Gene: |
Rr329 Location: Chr11:6589950-6590001 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr329em2Mam page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: CRISPR-targeting using sgRNAs (targeting GGCCTAAGACACAGGGCCTTCT and GGCTGCTTGAGTTTCCCAGA) deleted 6 bp (AGAAGG), which includes part of the interferonactivated sequence (GAS) motif, within the E2 enhancer (part of Wap super enhancer) upstream of Wap.
(J:277922)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr329 Mutation: |
0 strains or lines available
|
|
|
|
| Original: |
J:277922 Shin HY, et al., Hierarchy within the mammary STAT5-driven Wap super-enhancer. Nat Genet. 2016 Aug;48(8):904-911 |
| All: |
1 reference(s) |
|
Analysis Tools
