Tg(Rr250407-Luc)3xPKmm
Transgene Detail
|
|
| Symbol: |
Tg(Rr250407-Luc)3xPKmm |
| Name: |
transgene insert 3xP, Kenneth M Murphy |
| MGI ID: |
MGI:7397296 |
| Synonyms: |
3xP Luciferase |
| Transgene: |
Tg(Rr250407-Luc)3xPKmm Location: unknown
|
| Alliance: |
Tg(Rr250407-Luc)3xPKmm page
|
|
|
|
| Transgene Type: |
|
Transgenic (Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: The transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12.
(J:40450)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
|
| Original: |
J:40450 Wenner CA, et al., Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J Immunol. 1997 Jan 15;158(2):765-73 |
| All: |
1 reference(s) |
|