About   Help   FAQ
Sp7em1(flpo)Oam
Endonuclease-mediated Allele Detail
Summary
Symbol: Sp7em1(flpo)Oam
Name: Sp7 transcription factor 7; endonuclease-mediated mutation 1, Ormond A MacDougald
MGI ID: MGI:7294193
Synonyms: Osterix-FLPo
Gene: Sp7  Location: Chr15:102265038-102275498 bp, - strand  Genetic Position: Chr15, 57.51 cM
Alliance: Sp7em1(flpo)Oam page
Mutation
origin
Strain of Origin:  C57BL/6 x SJL
Mutation
description
Allele Type:    Endonuclease-mediated (Recombinase)
Mutation:    Insertion
 
Sp7em1(flpo)Oam expression driven by 1 gene
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing was used to insert an in frame protein containing Sp7-P2A-Flpo sequence- polyA into the 3' UTR of the gene The self-cleaving P2A sequence allows for expression of Sp7 and flpo recombinase. Cas9 protein, sgRNA (gatctgagctgggtagaggaagg), and ssDNA donor were mixed and injected into the pronucleus of C57BL/6J x SJL fertilized zygotes. (J:325967)
Recombinase
activity
Activity:
 Tissue activity of this recombinase allele
Driver: Sp7 (mouse)
Summary of all recombinase alleles driven by Sp7.
 

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sp7 Mutation:  26 strains or lines available
References
Original:  J:325967 Li Z, et al., Lipolysis of bone marrow adipocytes is required to fuel bone and the marrow niche during energy deficits. Elife. 2022 Jun 22;11:e78496
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory