D8Mit9 Primer Detail MGI Mouse MGI:707579

D8Mit9 Primer Detail

Name

D8Mit9
Primer 1 Sequence

ATTTGAATTGTGCAGACCTGG
Primer 2 Sequence

CTGCTTGTTTTTATCTCCTGGG
ID

MGI:707579
Product Size

150
Other IDs

D8Mit9 (BROAD)
Note

MIT assay: A62
Additional information: MIT STS Marker Data Files

D8Mit9

DNA segment, Chr 8, Massachusetts Institute of Technology 9

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit9	m	155bp	MOLF/EiJ
Not Specified	D8Mit9	s	120bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit9	a	114bp	SPRET/EiJ
	b	118bp	CAST/EiJ
	c	139bp	AKR/J
	d	149bp	BALB/cJ, C3H/HeJ, DBA/2J
	e	151bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23