D17Mit176 Primer Detail MGI Mouse MGI:707308

D17Mit176 Primer Detail

Name

D17Mit176
Primer 1 Sequence

GCCTAACTAGACTACAAGCCTTGC
Primer 2 Sequence

GTAGGTACATACAACCCACATACAGG
ID

MGI:707308
Product Size

167
Other IDs

D17Mit176 (BROAD)
Note

MIT assay: MT3716
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 176

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit176	a	176bp	129X1/Sv
Not Specified	D17Mit176	f	176, 182bp	CD-1

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit176	a	smallest	A.CA-H2^f/Sn
		b	larger	CAST/EiJ
		c	larger than above	RIIIS/J
		d	larger than above	DBA/2J, SJL/J, SWR/J
		e	larger than above	C57BL/6J, M. caroli, SM/J
		f	larger than above	CBA/J, M. spretus
		g	larger than above	P/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit176	a	154bp	NOD/MrkTac
	b	160bp	A/J
	c	162bp	CAST/EiJ, LP/J
	d	172bp	DBA/2J, NON/ShiLt
	e	174bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	176bp	BALB/cJ
	g	182bp	AKR/J, C3H/HeJ
	h	184bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit176	c	175bp	CBA/CaOlaHsd
	D17Mit176	s	167bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23