About   Help   FAQ
D9Mit11 Primer Detail
Primers
  • Name
    D9Mit11
  • Primer 1 Sequence
    GCCTTCATGTGTACCTGAATGCAC
  • Primer 2 Sequence
    GGCTCTGTAATCACTGAAGCTGGT
  • ID
    MGI:707283
  • Product Size
    48
  • Other IDs
    D9Mit11 (BROAD)
  • Note
    MIT assay: L60
    Additional information: MIT STS Marker Data Files
Genes
D9Mit11 DNA segment, Chr 9, Massachusetts Institute of Technology 11
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit11 c 116bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit11 a 74bp B6.Cg-Lepob/+, C57BL/6J
b 97bp LP/J
c 99bp CAST/EiJ
d 104bp DBA/2J
e 112bp AKR/J, NOD/MrkTac
f 114bp NON/ShiLt
g 116bp A/J, BALB/cJ, C3H/HeJ
h 137bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory