DXMit74 Primer Detail MGI Mouse MGI:707044

DXMit74 Primer Detail

Name

DXMit74
Primer 1 Sequence

TCTCATTTAGAAACACTCTCTCATGC
Primer 2 Sequence

TATTTGTTCAAGAATCAGTGTATTTGC
ID

MGI:707044
Product Size

138
Other IDs

DXMit74 (BROAD)
Note

MIT assay: MT899
Additional information: MIT STS Marker Data Files

DXMit74

DNA segment, Chr X, Massachusetts Institute of Technology 74

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit74	a	114bp	SPRET/EiJ
	b	137bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	141bp	CAST/EiJ
	d	143bp	A/J, BALB/cJ, C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
DXMit74	c	131bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
	d	125bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	p	123bp	JF1, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23