D10Mit180 Primer Detail MGI Mouse MGI:706913

D10Mit180 Primer Detail

Name

D10Mit180
Primer 1 Sequence

GACCTTCCTTTATACACAAGTCATAGC
Primer 2 Sequence

GTGGTACAGAACTTAGGTGTTTAATTG
ID

MGI:706913
Product Size

134
Other IDs

D10Mit180 (BROAD)
Note

MIT assay: MT3119
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 180

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit180	a	206bp	129X1/Sv
Not Specified	D10Mit180	f	134, 206bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit180	c	206bp	C3HeB/FeJLe
	D10Mit180	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit180	a	108bp	SPRET/EiJ
	b	126bp	CAST/EiJ
	c	134bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	156bp	A/J, BALB/cJ, DBA/2J, NOD/MrkTac
	e	206bp	AKR/J, C3H/HeJ, LP/J

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit180	a	larger	129P3/J
	D10Mit180	s	smaller	SJL/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit180	c	upper	CBA/Kw
	D10Mit180	e	lower	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23