D15Mit11 Primer Detail MGI Mouse MGI:706879

D15Mit11 Primer Detail

Name

D15Mit11
Primer 1 Sequence

TGTGAGAAAAATGACAGTAAGGC
Primer 2 Sequence

TCACAGAAAGACAAGACAAAAGG
ID

MGI:706879
Product Size

99
Other IDs

D15Mit11 (BROAD)
Note

MIT assay: M237
Additional information: MIT STS Marker Data Files

D15Mit11

DNA segment, Chr 15, Massachusetts Institute of Technology 11

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit11	a	121bp	129X1/Sv
Not Specified	D15Mit11	f	106, 121bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D15Mit11	m	100bp	MOLF/EiJ
Not Specified	D15Mit11	s	110bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit11	a	94bp	A/J
	b	106bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	110bp	SPRET/EiJ
	d	121bp	AKR/J
	e	126bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23