D5Mit409 Primer Detail MGI Mouse MGI:706285

D5Mit409 Primer Detail

Name

D5Mit409
Primer 1 Sequence

GACACAGTTTGGTCACTTGCA
Primer 2 Sequence

ACACACTCTCTCTATTCCACTTTCTG
ID

MGI:706285
Product Size

198
Other IDs

D5Mit409 (BROAD)
Note

MIT assay: MTH1717
Additional information: MIT STS Marker Data Files

D5Mit409

DNA Segment, Chr 5 Massachusetts Institute of Technology 409

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit409	a	196bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	192bp	129X1/SvJ
		c	196, 202, 214bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit409	a	152bp	SPRET/EiJ
	b	196bp	AKR/J, LP/J
	c	198bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	214bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	e	242bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23