About   Help   FAQ
D10Mit271 Primer Detail
Primers
  • Name
    D10Mit271
  • Primer 1 Sequence
    ACAACCAAAGGTCTTTGTAGAAGA
  • Primer 2 Sequence
    AATATATAGGCACACCTTAATAGCCA
  • ID
    MGI:706179
  • Product Size
    117
  • Other IDs
    D10Mit271 (BROAD)
  • Note
    MIT assay: MTH1299
    Additional information: MIT STS Marker Data Files
Genes
D10Mit271 DNA Segment, Chr 10, Massachusetts Institute of Technology 271
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit271 a 104bp AKR/J, C3H/HeJ
b 106bp LP/J
c 108bp SPRET/EiJ
d 110bp CAST/EiJ
e 112bp A/J, BALB/cJ
f 116bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit271 a 102bp AKR/OlaHsd
c 110bp A/JOlaHsd, BALB/cJ
d 114bp 129P3/J, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB
h 100bp C3H/HeJ, SJL/J
j 116bp JF1
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory