D19Mit91 Primer Detail MGI Mouse MGI:705967

D19Mit91 Primer Detail

Name

D19Mit91
Primer 1 Sequence

GGGTTGGCTCAATACTCCAA
Primer 2 Sequence

CCCCCACCTGGTATCTTGAG
ID

MGI:705967
Product Size

109
Other IDs

D19Mit91 (BROAD)
Note

MIT assay: MT4012
Additional information: MIT STS Marker Data Files

D19Mit91

DNA segment, Chr 19, Massachusetts Institute of Technology 91

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit91	a	90bp	129X1/Sv
Not Specified	D19Mit91	f	94, 98bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit91	c	90bp	C3HeB/FeJLe
	D19Mit91	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit91	a	90bp	C3H/HeJ, NOD/MrkTac
	b	94bp	CAST/EiJ
	c	112bp	B6.Cg-Lep^ob/+, C57BL/6J, SPRET/EiJ
	d	132bp	AKR/J, NON/ShiLt
	e	134bp	A/J, BALB/cJ, DBA/2J, LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit91	c	137bp	CBA/CaOlaHsd
	D19Mit91	s	135bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit91	a	larger	129P3/J
	D19Mit91	s	smaller	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23