D9Mit269 Primer Detail MGI Mouse MGI:705934

D9Mit269 Primer Detail

Name

D9Mit269
Primer 1 Sequence

TTTTTGGACTAATAGTCAACTGTGTAA
Primer 2 Sequence

AGGAAGACTGAAAACTTGTGGG
ID

MGI:705934
Product Size

172
Other IDs

D9Mit269 (BROAD)
Note

MIT assay: MT5025
Additional information: MIT STS Marker Data Files

D9Mit269

DNA segment, Chr 9, Massachusetts Institute of Technology 269

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit269	a	130bp	SPRET/EiJ
	b	148bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	c	166bp	AKR/J, DBA/2J, NOD/MrkTac
	d	172bp	NON/ShiLt
	e	176bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	178bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D9Mit269	b	164bp	C57BL/6JOlaHsd
	c	138bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	156bp	AKR/OlaHsd, DBA/2J
	j	190bp	JF1
	l	136bp	SJL/J
	p	182bp	PWB
	r	162bp	C57BL/10

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit269	a	176bp	C57BL/6W, C57BL/10W, CBA/W
	b	166bp	AKR/W, DBA/2W
	c	148bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23