About   Help   FAQ
D17Mit59 Primer Detail
Primers
  • Name
    D17Mit59
  • Primer 1 Sequence
    CTGTGGAACCCAGTGCATC
  • Primer 2 Sequence
    TGTCTCAATGTAGGTTTGGGC
  • ID
    MGI:705851
  • Product Size
    147
  • Other IDs
    D17Mit59 (BROAD)
  • Note
    MIT assay: MPC274
    Additional information: MIT STS Marker Data Files
Genes
D17Mit59 DNA segment, Chr 17, Massachusetts Institute of Technology 59
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit59 b 148bp BALB/cJ, C57BL/6J
s 146bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit59 a 144bp A/J, NOD/MrkTac
b 146bp B6.Cg-Lepob/+
c 148bp BALB/cJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
d 150bp C3H/HeJ
e 152bp AKR/J
f 154bp CAST/EiJ
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory