D10Mit36 Primer Detail MGI Mouse MGI:705793

D10Mit36 Primer Detail

Name

D10Mit36
Primer 1 Sequence

GGCTTTGGGGATAGCATTG
Primer 2 Sequence

AACATGCTGTCGAACAGAAGC
ID

MGI:705793
Product Size

144
Other IDs

D10Mit36 (BROAD)
Note

MIT assay: B317
Additional information: MIT STS Marker Data Files

D10Mit36

DNA segment, Chr 10, Massachusetts Institute of Technology 36

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit36	a	138bp	129X1/Sv
Not Specified	D10Mit36	f	142bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit36	a	138bp	BALB/cJ, LP/J, NON/ShiLt
	b	142bp	CAST/EiJ
	c	146bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
	d	148bp	DBA/2J
	e	160bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit36	a	145bp	A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	137bp	129P3/J, BALB/cJ
	d	147bp	DBA/2J
	p	129bp	JF1, PWB

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23