D17Mit52 Primer Detail MGI Mouse MGI:705392

D17Mit52 Primer Detail

Name

D17Mit52
Primer 1 Sequence

TCTGCCCTGTAACAGGAGCT
Primer 2 Sequence

CTTCTGGAATCAGAGGATCCC
ID

MGI:705392
Product Size

154
Note

MIT assay: B525

D17Mit52

DNA segment, Chr 17, Massachusetts Institute of Technology 52

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit52	a	large	STOCK t¹²
		b	larger	STOCK t^w5
		c	smallest	C3H, STOCK t^w12

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit52	a	132bp	129X1/Sv
Not Specified	D17Mit52	f	124, 128, 132bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit52	a	134bp	SPRET/EiJ
	b	140bp	AKR/J, C3H/HeJ
	c	150bp	A/J
	d	152bp	DBA/2J, NOD/MrkTac, NON/ShiLt
	e	154bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	156bp	BALB/cJ
	g	162bp	CAST/EiJ, LP/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit52	c	143bp	CBA/CaOlaHsd
	D17Mit52	s	142bp	SWR/OlaHsd

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23