About   Help   FAQ
D17Mit51 Primer Detail
Primers
  • Name
    D17Mit51
  • Primer 1 Sequence
    TCTGCCCTGTAACAGGAGCT
  • Primer 2 Sequence
    CTTCTGGAATCAGAGGATCCC
  • ID
    MGI:705389
  • Product Size
    154
  • Other IDs
    D17Mit51 (BROAD)
  • Note
    MIT assay: B563
    Additional information: MIT STS Marker Data Files
Genes
D17Mit51 DNA segment, Chr 17, Massachusetts Institute of Technology 51
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit51 a 124bp SPRET/EiJ
b 128bp AKR/J, C3H/HeJ
c 140bp A/J, NOD/MrkTac
d 142bp DBA/2J
e 144bp B6.Cg-Lepob/+, C57BL/6J
f 146bp BALB/cJ
g 150bp LP/J
h 152bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit51 l smaller LG/J
s larger SM/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit51 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/16/2024
MGI 6.23 		The Jackson Laboratory