D2Mit311 Primer Detail MGI Mouse MGI:705247

D2Mit311 Primer Detail

Name

D2Mit311
Primer 1 Sequence

ACAGGCAGCCTTCCCTTC
Primer 2 Sequence

TCTGTCCCGCTTCTGTTTCT
ID

MGI:705247
Product Size

126
Other IDs

D2Mit311 (BROAD)
Note

MIT assay: MT3522
Additional information: MIT STS Marker Data Files

D2Mit311

DNA segment, Chr 2, Massachusetts Institute of Technology 311

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit311	a	122bp	129X1/Sv
Not Specified	D2Mit311	f	108, 114, 128bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit311	a	108bp	AKR/J, C3H/HeJ, DBA/2J
	b	114bp	A/J, BALB/cJ, CAST/EiJ, NOD/MrkTac
	c	116bp	SPRET/EiJ
	d	122bp	LP/J
	e	128bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	134bp	NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23