D9Mit96 Primer Detail MGI Mouse MGI:705117

D9Mit96 Primer Detail

Name

D9Mit96
Primer 1 Sequence

TGGTTTGCTTCAGCTCCTTT
Primer 2 Sequence

GTTAGTGCACTGTCTCAGCCC
ID

MGI:705117
Product Size

205
Other IDs

D9Mit96 (BROAD)
Note

MIT assay: D916
Additional information: MIT STS Marker Data Files

D9Mit96

DNA segment, Chr 9, Massachusetts Institute of Technology 96

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit96	a	147bp	SPRET/EiJ
	b	190bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	194bp	LP/J
	d	204bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	e	212bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit96	a	204bp	CBA/W
	b	200bp	A.CA/W, BALB/cW, C3H/W, DBA/2W
	c	190bp	129/SvW
	d	180bp	AKR/W, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23