D15Mit111 Primer Detail MGI Mouse MGI:704942

D15Mit111 Primer Detail

Name

D15Mit111
Primer 1 Sequence

GTTTCAGAAGGCAATGTCTGG
Primer 2 Sequence

GCTCAGTGCTAATCTCTGACTCC
ID

MGI:704942
Product Size

170
Other IDs

D15Mit111 (BROAD)
Note

MIT assay: MT1059
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 111

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit111	c	189bp	C3HeB/FeJLe
	D15Mit111	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit111	a	167bp	AKR/J, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	b	181bp	A/J
	c	189bp	C3H/HeJ, DBA/2J
	d	190bp	CAST/EiJ
	e	213bp	LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit111	a	197bp	DBA/2W
	b	189bp	129/SvW, A.CA/W, C3H/W, CBA/W
	c	167bp	AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23