D2Mit11 Primer Detail MGI Mouse MGI:704835

D2Mit11 Primer Detail

Name

D2Mit11
Primer 1 Sequence

CAAACCCCCAGCTCTCTCTT
Primer 2 Sequence

CCATACCCAGGCTCCATCTA
ID

MGI:704835
Product Size

225
Other IDs

D2Mit11 (BROAD)
Note

MIT assay: M134
Additional information: MIT STS Marker Data Files

D2Mit11

DNA segment, Chr 2, Massachusetts Institute of Technology 11

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit11	a	226bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	b	232bp	A/J, AKR/J, BALB/cJ, CAST/EiJ, LP/J, NOD/MrkTac
	c	264bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit11	l	larger	LG/J
	D2Mit11	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit11	a	232bp	A.CA/W, AKR/W, BALB/cW
	D2Mit11	b	226bp	129/SvW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23