About   Help   FAQ
D6Mit243 Primer Detail
Primers
  • Name
    D6Mit243
  • Primer 1 Sequence
    CTGCTTGTCCTTTGACCTCC
  • Primer 2 Sequence
    CTGGTTTCCTGATTTTTATATTAAATG
  • ID
    MGI:704743
  • Product Size
    116
  • Other IDs
    D6Mit243 (BROAD)
  • Note
    MIT assay: MJ4317
    Additional information: MIT STS Marker Data Files
Genes
D6Mit243 DNA segment, Chr 6, Massachusetts Institute of Technology 243
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit243 a 96bp SPRET/EiJ
b 116bp LP/J, NON/ShiLt
c 118bp B6.Cg-Lepob/+, C57BL/6J
d 120bp A/J, BALB/cJ
e 124bp CAST/EiJ
f 132bp AKR/J, NOD/MrkTac
g 136bp C3H/HeJ, DBA/2J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D6Mit243 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit243 c 133bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/16/2024
MGI 6.23 		The Jackson Laboratory